Apa itu Sulforaphane? | El Paso, TX Dokter Kiropraktik
Dr. Alex Jimenez, Chiropractor El Paso
Saya harap Anda menikmati posting blog kami tentang berbagai topik kesehatan, gizi dan cedera. Jangan ragu untuk menghubungi kami atau saya sendiri jika ada pertanyaan saat kebutuhan untuk mencari perawatan muncul. Hubungi kantor atau saya sendiri. Office 915-850-0900 - Sel 915-540-8444 Great Regards. Dr. J

Sulforaphane adalah fitokimia, zat dalam kelompok isothiocyanate senyawa organosulfur, ditemukan dalam sayuran silangan, seperti brokoli, kubis, kembang kol, dan kubis Brussel. Ini juga dapat ditemukan di bok choy, kale, sawi, sawi dan selada air. Studi penelitian menunjukkan bahwa sulforaphane dapat membantu mencegah berbagai jenis kanker mengaktifkan produksi Nrf2, atau faktor faktor 2 erythroid terkait nuklir, faktor transkripsi yang mengatur mekanisme antioksidan pelindung yang mengontrol respon sel terhadap oksidan. Tujuan dari artikel berikut adalah untuk menggambarkan fungsi sulforaphane.

Abstrak

Sistem antioksidan KEAP1-Nrf2-ARE adalah sarana utama dimana sel-sel merespon terhadap tekanan oksidatif dan xenobiotik. Sulforaphane (SFN), isothiocyanate elektrofilik yang berasal dari sayuran silangan, mengaktifkan jalur KEAP1-Nrf2-ARE dan telah menjadi molekul yang menarik dalam pengobatan penyakit di mana stres oksidatif kronis memainkan peran etiologi utama. Kami menunjukkan di sini bahwa mitokondria dari pigmen retina pigmen manusia (RPE-1) yang diobati dengan SFN mengalami hiperfusi yang independen dari Nrf2 dan inhibitor sitoplasmik KEAP1. Fusi mitokondria telah dilaporkan menjadi sitoprotektif dengan menghambat pembentukan pori di mitokondria selama apoptosis, dan konsisten dengan ini, kami menunjukkan Nrf2-independen, sitoproteksi sel-sel yang diobati dengan SFN yang terpapar pada inducer apoptosis, staurosporine. Secara mekanis, SFN mengurangi perekrutan dan / atau retensi faktor fisi terlarut Drp1 ke mitokondria dan peroksisom tetapi tidak mempengaruhi kelimpahan Drp1 secara keseluruhan. Data ini menunjukkan bahwa sifat menguntungkan dari SFN melampaui aktivasi sistem KEAP1-Nrf2-ARE dan menjamin interogasi lebih lanjut mengingat penggunaan saat ini agen ini dalam beberapa uji klinis.

Kata kunci: Sulforaphane, Nrf2, Drp1, Mitochondria, Fission, Fusion, Apoptosis

pengantar

Sulforaphane adalah Nrf2-Independent Inhibitor dari Mitochondrial Fission

Sulforaphane (SFN) adalah senyawa isothiocyanate yang berasal dari makanan yang paling umum dari sayuran silangan [56]. Ini dihasilkan pada tanaman sebagai respon xenobiotik terhadap predasi melalui pelepasan vesikular myosinase enzim hidrolitik dari sel yang rusak; enzim ini mengubah glukosinolat menjadi isothiocyantes [42]. Selama dua dekade terakhir, SFN telah secara ekstensif dicirikan untuk sifat antikanker, antioksidan, dan antimikrobanya yang dilaporkan [57]. Sebagian besar kemanjuran ini telah dikaitkan dengan kapasitas SFN untuk memodulasi jalur sinyal penandaan KEAP1-Nrf2-antioxidant element (ARE), meskipun aktivitas tambahan dari senyawa telah diidentifikasi, termasuk penghambatan aktivitas histone deacetylase dan perkembangan siklus sel [ 29]. Nrf2 adalah faktor transkripsi antioksidan utama dan dalam kondisi homeostasis, stabilitasnya ditekan melalui aksi cytoplasmic Cullin3KEAP1 ubiquitin ligase complex [20]. Secara khusus, Nrf2 direkrut ke Cullin3KEAP1 ligase dengan mengikat ke adaptor substrat dimeric KEAP1 dan kemudian dimodifikasi dengan rantai polyub yang menargetkan faktor transkripsi untuk degradasi berperantara proteasome. Omzet konstitutif ini membatasi waktu paruh Nrf2 dalam sel tanpa tekanan hingga ~ 15 menit [30], [33], [46], [55]. Menanggapi berbagai jenis stres, terutama stres oksidatif, KEAP1, protein yang kaya sistein, bertindak sebagai sensor redoks, dan modifikasi oksidatif sistein penting, terutama C151, KEAP1 memisahkan Nrf2-KEAP1 dari CUL3 sehingga mencegah degradasi Nrf2 [ 8], [20], [55]. Khususnya, SFN, dan mungkin aktivator Nrf2 lainnya, meniru stres oksidatif dengan memodifikasi C151 dari KEAP1 misalnya [21]. Stabilisasi Nrf2 memungkinkan translokasi ke nukleus di mana ia menginduksi ekspresi baterai dari antioksidan fase II dan gen detoksifikasi. Nrf2 berikatan dengan elemen promotor respon antioksidan (ARE) dari gen targetnya yang diwaspadai melalui heterodimerisasi dengan protein Maf kecil [19]. Sistem ini menyajikan respon yang dinamis dan sensitif terhadap antioksidan tidak langsung seperti SFN, radikal bebas yang dihasilkan oleh mitokondria [16], atau sumber fisiologis lain dari stres oksidatif [41].

Mitokondria adalah organel subselular yang dinamis yang mengatur sejumlah fungsi seluler mulai dari produksi ATP dan buffer kalsium intraseluler hingga regulasi redoks dan apoptosis [13], [49]. Mitokondria juga merupakan sumber utama spesies oksigen reaktif (ROS) di dalam sel. Pengaturan yang tepat dari fungsi mitokondria karena itu diperlukan untuk mengoptimalkan produksi ATP untuk memenuhi kebutuhan seluler sambil meminimalkan efek yang berpotensi membahayakan dari produksi radikal bebas yang berlebihan. Persyaratan penting untuk modulasi halus fungsi mitokondria adalah kapasitas mitokondria berfungsi baik secara independen sebagai mesin biokimia dan sebagai bagian dari jaringan yang luas dan responsif.

Morfologi dan fungsi mitokondria ditentukan oleh keseimbangan yang diatur antara fisi dan fusi. Fisi mitokondria diperlukan untuk mewarisi sel anak mitokondria selama pembelahan sel [28] serta untuk degradasi, selektif, autophagic dari depolarized atau kerusakan mitokondria, disebut mitophagy [1]. Sebaliknya, fusi diperlukan untuk melengkapi genom mitokondria dan berbagi komponen rantai transpor elektron antara mitokondria yang berdekatan [54]. Pada tingkat molekuler, fisi dan fusi mitokondria diatur oleh GTPase besar yang menyerupai dynamin. Tiga enzim terutama mengatur fusi: Mitofusins ​​1 dan 2 (Mfn1 / 2) adalah protein membran luar dua-pass yang memediasi fusi membran luar melalui interaksi heterotypic antara mitokondria yang berdekatan [15], [25], [37], sementara OPA1 adalah bagian dalam protein membran yang secara bersamaan memastikan konektivitas matriks dengan mengatur penyatuan membran bagian dalam [5]. Aktivitas GTPase dari ketiga protein diperlukan untuk fusi kuat [5], [18], dan OPA1 lebih lanjut diatur oleh proteolisis kompleks dalam membran dalam mitokondria oleh protease OMA1 [14], PARL [6], dan YME1L [45 ]. Yang penting, potensi membran mitokondria yang utuh diperlukan untuk penggabungan yang efisien untuk menekan integrasi mitokondria yang rusak dan sehat [26].

Fisi mitokondria terutama dikatalisasi oleh protein sitosol yang disebut protein yang terkait dengan Dynamo 1 (Drp1 / DNM1L). Drp1 direkrut dari sitosol ke situs prospektif fisi pada membran luar mitokondria [43]. Reseptor utama untuk Drp1 pada membran luar adalah faktor fisi mitokondria (Mff) [32] dan, pada tingkat lebih rendah, Fisi 1 (Fis1) [51]. Selain itu, reseptor umpan, MIEF1 / MiD51, ditemukan yang bertindak untuk lebih membatasi aktivitas protein Drp1 di situs fisi potensial [58]. Setelah berlabuh di membran luar mitokondria, Drp1 oligomerizes ke dalam struktur seperti spiral di sekitar tubuh mitokondria dan kemudian memanfaatkan energi yang berasal dari hidrolisis GTP untuk memediasi pencabutan fisik membran luar dan dalam mitokondria [17]. Endoplasmic-derived tubules bertindak sebagai pembatas awal mitokondria sebelum oligomerisasi Drp1, menggarisbawahi wahyu bahwa mitokondria non-terbatas lebih lebar daripada lingkar permisif dari spiral Drp1 yang lengkap [12]. Dinamika aktin juga penting untuk interaksi ER-mitokondria yang mendahului fisi mitokondria [24]. Selain perannya dalam fisi mitokondria, Drp1 mengkatalisis fisi peroksisom [40].

Drp1 sangat mirip dengan protein dynamin berkarakter baik dalam kedua protein yang mengandung domain GTPase N-terminal, domain menengah yang penting untuk self-oligomerization, dan domain efektor GTPase C-terminal [31]. Drp1 mencapai selektivitas untuk membran mitokondria melalui kombinasi interaksi dengan protein reseptornya Mff dan Fis1 dan juga melalui afinitasnya untuk kardiolipin fosfolipid mitokondria spesifik melalui domain B-insert unik dari Drp1 [2]. Drp1 biasanya ada sebagai homotetramer di sitoplasma, dan susunan urutan yang lebih tinggi di situs fisi mitokondria diperantarai oleh domain Tengah Drp1 [3].

Mengingat hubungan implisit antara fungsi mitokondria dan jalur KEAP1-Nrf2-ARE, kami menyelidiki efek aktivasi Nrf2 pada struktur dan fungsi mitokondria. Kami menunjukkan di sini bahwa SFN menginduksi hyperfusion mitokondria yang, tanpa diduga, tidak bergantung pada Nrf2 dan KEAP1. Efek dari SFN ini adalah melalui penghambatan fungsi Drp1. Kami lebih lanjut menunjukkan bahwa SFN memberikan resistansi terhadap apoptosis yang Nrf2-independen dan meniru yang diamati dalam sel-sel habis Drp1. Data ini secara kolektif menunjukkan bahwa selain menstabilkan dan mengaktifkan Nrf2, SFN memodulasi dinamika mitokondria dan mempertahankan kebugaran dan kelangsungan seluler.

Hasil

Sulforaphane Menginduksi Nrf2 / KEAP1-Independent Hyperfusion of Mitochondria

Dalam mempelajari efek aktivasi Nrf2 pada dinamika jaringan mitokondria, kami menemukan bahwa pengobatan pigmen retina pigmen manusia (RPE-1) yang diabadikan dengan sulforaphane (SFN), pengaktif potensial pensinyalan Nrf2, menginduksi fusi kuat dari jaringan mitokondria bila dibandingkan dengan sel kontrol yang dirawat-kendaraan (Gambar. 1A dan B). Morfologi mitokondria dalam sel-sel ini sangat mirip dengan mitokondria dalam sel yang dihabiskan oleh siRNA Drp1 endogen, faktor fisi mitokondria utama (Gambar 1A). Hasil ini membangkitkan ide yang menarik bahwa fisi mitokondria dan status fusi merespon langsung ke tingkat Nrf2 di dalam sel. Namun, stimulasi sel dengan penstabil Nrf2 lain dan aktivator seperti inhibitor proteasome MG132, tBHQ pro-oksidan, atau knockdown dari inhibitor Nrf2 KEAP1 tidak menginduksi fusi mitokondria (Gambar 1A dan B). Stabilisasi Nrf2 oleh manipulasi ini dikonfirmasi oleh western blotting untuk Nrf2 endogen (Gambar 1C). Lebih lanjut, ekspresi Nrf2 tidak dapat digunakan untuk fusi mitokondria yang diinduksi SFN, seperti knockdown Nrf2 endogen dengan siRNA gagal melawan fenotipe ini (Gambar 1D – F). Karena SFN menstimulasi jalur KEAP1-Nrf2-ARE dengan memodifikasi sistein residu cystaline dari KEAP1 [21], kami merobohkan KEAP1 untuk mengatasi apakah hiperfusi mitokondria yang diinduksi SFN dirangsang melalui KEAP1-dependent, tetapi jalur independen Nrf2. Namun, penipisan KEAP1 juga gagal untuk mencabut fusi mitokondria yang diinduksi SFN (Gambar 1G – I). Bahkan, SFN membalikkan morfologi pro-fisi yang disebabkan oleh deplesi KEAP1 (Gambar. 1G, panel b versus panel d). Hasil ini menunjukkan bahwa pengobatan SFN menyebabkan fusi mitokondria independen dari jalur KEAP1-Nrf2-ARE canonical dan memimpin kita untuk menginterogasi apakah SFN secara langsung mempengaruhi komponen fisi mitokondria atau mesin fusi.

Gambar 1 SFN menginduksi fusi mitokondria Nrf2 / KEAP1-independen. (A) Sel RPE-1 ditransfeksikan dengan diindikasikan siRNA dan 3 hari kemudian diobati dengan DMSO atau aktivator Nrf2 SFN (50 μM), MG132 (10 μM), atau tBHQ (100 μM) untuk 4 h. Mitokondria (merah) diberi label dengan antibodi anti-Tom20, dan nuklei (biru) dipasangkan dengan DAPI. (B) Grafik yang menunjukkan kuantifikasi skor morfologi mitokondria dari (A). > Sel 50 per kondisi dievaluasi dengan cara blinded. (C) Perwakilan western blot dari (A). (D) Sel RPE-1 ditransfeksikan dengan 10 nM siRNA dan 3 hari kemudian diobati dengan SFN untuk 4 h sebelum diperbaiki dan ternoda seperti pada (A). (E) Grafik yang menunjukkan kuantifikasi skor fenotip mitokondria dari (D). > Sel 100 per kondisi dievaluasi dengan cara blinded. (F) Perwakilan western blot dari (D). (G) Sel ditransfeksikan dan diperlakukan seperti pada (D) dengan siCON atau siKEAP1. (H) Sel dari (G) diberi skor seperti dalam (B) dan (E) atas dasar morfologi mitokondria. (I) Perwakilan western blot dari (G). Data dalam (B), (E), dan (H) dikompilasi dari masing-masing eksperimen independen 3 dan signifikansi statistik ditentukan oleh t-test Student dua arah. Bar kesalahan mencerminkan +/- SD (Untuk interpretasi referensi warna dalam legenda gambar ini, pembaca mengacu pada versi web artikel ini).

Sulforaphane merusak Asosiasi Mitokondria Drp1

Berdasarkan temuan bahwa pengobatan SFN menginduksi hiperfusi mitokondria, kami beralasan bahwa fenotip ini merupakan konsekuensi dari aktivitas fusi berlebihan atau penghambatan aktivitas fisi. Untuk membedakan antara dua kemungkinan ini, kami membandingkan morfologi peroksisom di hadapan dan tidak adanya SFN. Peroksisom mirip dengan mitokondria karena mereka adalah organel yang dinamis bentuk dan panjangnya yang terus-menerus berubah [44]. Peroksisom mengandung Fis1 dan Mff di membran luarnya dan, sebagai konsekuensinya, adalah target untuk fisi yang dimediasi Drp1 [22], [23]. Namun, peroksisom tidak menggunakan mesin fusi jaringan mitokondria dan akibatnya, tidak mengalami fusi [39]. Sebaliknya, fisi peroxisomal ditentang oleh pemanjangan peroxisomes yang ada melalui de novo penambahan membran dan protein [44]. Karena peroxisomes tidak memiliki Mfn1 / 2 dan OPA1, kami beralasan bahwa jika SFN mengaktifkan fusion machinery daripada menghambat mesin fisi, panjang peroxisome tidak akan terpengaruh. Dalam sel yang diperlakukan dengan kendaraan, peroksisom dipertahankan sebagai organel pendek, bulat, dan beraksis (Gambar 2, panel b dan d). Namun, pengobatan SFN meningkatkan panjang peroksisom oleh ~ 2-fold dibandingkan dengan sel kontrol (Gambar. 2, panel f dan h). Selanjutnya, banyak peroksisom yang terjepit di dekat pusat, menunjukkan cacat scission potensial (Gambar. 2, panel h, kepala panah). Demikian pula, peroksisom dalam sel yang ditransfeksikan dengan SiRNA SiOpalnya sangat panjang (Gambar 1, panel j dan l), yang menegaskan bahwa Drp2 diperlukan untuk fisi peroksisomal dan menyarankan bahwa pengobatan SFN menyebabkan fenotip mitokondria dan peroksisom dengan mengganggu mesin fisi.

Gambar 2 SFN menginduksi peroxisomal memanjang. (A) Sel RPE-1 ditransfeksikan dengan 10 nM dari hari siRNA dan 3 yang diindikasikan kemudian diobati dengan DMSO atau 50 μM SFN untuk 4 h. Peroksisom (hijau) diberi label dengan antibodi anti-PMP70, mitokondria dengan MitoTracker (merah), dan DNA yang dipasangkan dengan DAPI. Insets peroxisomes membesar ditunjukkan di sebelah kanan (panel d, h, dan l) untuk memfasilitasi visualisasi perubahan morfologi yang disebabkan oleh SFN dan Drp1 deplesi. Panah menyoroti titik-titik penyempitan. (Untuk interpretasi referensi untuk warna dalam legenda tokoh ini, pembaca mengacu pada versi web artikel ini).

Kami selanjutnya menentukan bagaimana SFN membatasi fungsi Drp1. Kemungkinan termasuk pengurangan dalam tingkat ekspresi, rekrutmen / retensi di mitokondria, oligomerisasi, atau aktivitas enzimatik dari GTPase. Defisit pada salah satu dari ini akan menghasilkan pengurangan fisi mitokondria dan hiperfusi. Kami tidak mendeteksi perubahan yang dapat direproduksi pada tingkat protein Drp1 setelah pengobatan SFN (Gambar. 1C dan 3A), dan karena itu disimpulkan bahwa SFN tidak mengubah stabilitas atau ekspresi Drp1, konsisten dengan Drp1 yang memiliki waktu paruh> 10 h [50] dan perawatan SFN kami memiliki durasi yang lebih pendek. Selanjutnya, kami menyelidiki apakah SFN mempengaruhi perekrutan atau retensi Drp1 ke mitokondria. Studi fraksinasi menunjukkan bahwa SFN menginduksi hilangnya Drp1 dari fraksi mitokondria (Gambar. 3A, jalur 7 – 8 dan Gambar. 3B). Seperti yang dilaporkan sebelumnya [43], hanya sebagian kecil dari Drp1 (~ 3%) dikaitkan dengan jaringan mitokondria pada waktu tertentu selama stabil kondisi dengan sebagian besar enzim yang berada di sitoplasma (Gambar. 3A, jalur 5 – 8). Data fraksinasi ini dikonfirmasi menggunakan analisis ko-lokalisasi yang menunjukkan pengurangan ~ 40% dalam mitokondria-dilokalisasi, pungutan Drp1 fokus setelah pengobatan SFN (Gambar 3C dan D). Bersama-sama, data ini menunjukkan bahwa fusi mitokondria yang diinduksi oleh SFN, setidaknya sebagian, karena asosiasi Drp1 yang dilemahkan dengan mitokondria. Data kami tidak membedakan antara apakah SFN mengganggu rekrutmen mitokondria versus retensi mitokondria Drp1, atau keduanya, karena analisis Drp1 endogen tidak setuju untuk memvisualisasikan GTPase dengan mikroskopi sel hidup.

Gambar 3 SFN menyebabkan hilangnya Drp1 dari mitokondria. (A) Fraksinasi subseluler sel RPE-1 mengikuti 4 h dari DMSO atau SFN. Seluruh sel lisat (WCL), nuklir (Nuc), cytosolic (Cyto), dan fraksi mitokondria (Mito) mentah diselesaikan oleh SDS-PAGE dan diproses untuk blotting barat dengan antibodi yang ditunjukkan. Migrasi penanda berat molekul ditunjukkan di sebelah kiri. (B) Grafik menunjukkan kuantifikasi densitometri Drp1 dalam fraksi yang ditunjukkan dari (A). (C) Sel RPE-1 ditransfeksi dengan 10 nM siCON atau siDrp1 dan 3 hari kemudian diobati dengan DMSO atau SFN untuk 4 h. Drp1 (hijau) divisualisasikan dengan antibodi anti-Drp1, mitokondria dengan MitoTracker (merah), dan inti dengan DAPI (biru). (D) Analisis co-lokalisasi otomatis dari sinyal Drp1 dan MitoTracker dari (C). Data dalam (B) dan (D) dikompilasi dari 3 dan 5 eksperimen independen, masing-masing, dan signifikansi statistik ditentukan oleh uji t Student dua-arah. Bar kesalahan mencerminkan +/- SD dan tanda bintang menunjukkan signifikansi statistik. (Untuk interpretasi referensi untuk warna dalam legenda tokoh ini, pembaca mengacu pada versi web artikel ini).

Sulforaphane Menyampaikan Perlindungan Terhadap Staurosportine-Induced Apoptosis Independen Nrf2

Pekerjaan sebelumnya telah menunjukkan bahwa fisi mitokondria bersifat permisif dalam pembentukan pori-pori di membran mitokondria luar yang dihasilkan oleh Bax / Bak selama apoptosis [11]. Drp1 telah terbukti secara selektif direkrut ke mitokondria selama apoptosis [11] dan, konsisten dengan ini, mitokondria terfragmentasi telah diamati pada awal proses [27]. Sebaliknya, penghambatan fisi mitokondria dianggap menghambat apoptosis dengan menghalangi pembentukan pori-pori membran luar yang memungkinkan untuk pelepasan sitokrom c [53]. Dengan demikian, stimulasi fusi mitokondria menunda perkembangan apoptosis yang disebabkan oleh senyawa termasuk staurosporine (STS) [14]. Untuk menentukan apakah SFN melindungi sel RPE-1 dari apoptosis yang dimediasi STS dan jika demikian, apakah ini memerlukan Nrf2, kami menetapkan suatu uji untuk dengan mudah menginduksi pembelahan polyPol ribosa polimerase (PARP), substrat caspase-3 aktif dan definitif penanda apoptosis. Perawatan sel RPE-1 dengan 1 µM ​​STS untuk 6 hanya menyebabkan pembelahan PARP yang sangat sederhana namun hal ini dicegah oleh SFN co-treatment (misalnya, Gambar. 4A, jalur 3 versus 4). Untuk meningkatkan ketahanan tes ini, kami lebih lanjut peka sel-sel untuk STS-diinduksi apoptosis dengan pra-mengobati mereka dengan siRNA menargetkan faktor anti-apoptosis, Bcl-XL. Pretreatment ini mengurangi ekspresi Bcl-XL dan pembelahan PARP yang dipromosikan secara signifikan sebagai fungsi waktu yang terpapar pada STS (Gambar 4B, membandingkan jalur 2 dengan jalur 4 – 10). Yang penting, 2 h pra-perawatan dengan SFN mengurangi pembelahan PARP pada sel yang terpapar pada STS (Gambar. 4C, jalur 3 versus 4 dan jalur 5 versus 6). Demikian juga, sel-sel secara stabil habis Nrf2 oleh CRISPR / Cas9 secara komparatif terlindung dari toksisitas STS oleh pra-perlakuan SFN (Gambar 4C, jalur 11 versus 12 dan jalur 13 versus 14 dan Gambar. 4D). Perlindungan ini diamati menggunakan pembelahan PARP (Gambar 4C dan D) dan morfologi seluler (Gambar 4E) sebagai pembacaan. Kemanjuran deplesi Nrf2 oleh CRISPR / Cas9 dikonfirmasi oleh western blotting (Gambar 4C, Nrf2 blot). Seperti yang diperkirakan, mengurangi sel-sel Drp1, yang juga menghasilkan fenotipe hiperfusi (Gambar 1A), juga memblok pembelahan PARP sebagai tanggapan terhadap STS dibandingkan dengan sel kontrol yang diinkubasi dengan SFN (Gambar 4F dan G). Bersama-sama, temuan ini konsisten dengan SFN memberikan perlindungan terhadap apoptosis melalui kapasitasnya untuk membatasi fungsi Drp1, independen dari stabilisasi dan aktivasi Nrf2.

Gambar 4 Efek cytoprotective SFN adalah independen dari ekspresi Nrf2 (A) RPE-1 sel pra-diobati dengan DMSO atau 50 μM SFN untuk 2 h sebelum perawatan dengan DMSO, 1 μM staurosporine (STS), atau 50 μM etoposide untuk 6 h dan diproses untuk blotting western anti-PARP. (B) Sel RPE-1 ditransfeksikan dengan 2.5 nM siCON, 1 nM siBcl-XL, atau 2.5 nM siBcl-XL dan 3 hari kemudian diobati dengan DMSO atau 1 μM STS untuk 2, 4, atau 6 h. Blot barat representatif ditunjukkan dan migrasi penanda berat molekul ditunjukkan di sebelah kiri. (C) CRISPR / Cas9-menghasilkan wild-type (Nrf2WT) dan Nrf2 knockout (Nrf2KO) Sel RPE-1 yang ditransfeksikan dengan 1 nM siBcl-XL dan 3 hari kemudian pra-diobati dengan DMSO atau 50 μM SFN untuk 2 h. Selanjutnya, sel-sel diobati dengan 1 μM STS untuk 2, 4, atau 6 h. Blot barat yang representatif dengan antibodi yang ditunjukkan ditunjukkan. (D) Kuantifikasi PARP yang terbelah sebagai persentase dari total PARP (dibelah + yang tidak tercemar) dari eksperimen independen 3. Yang penting, tingkat PARP dibelah sebanding apakah sel mengekspresikan Nrf2 atau tidak, menunjukkan bahwa perlindungan SFN dari STS tidak bergantung pada faktor transkripsi. (E) 20X fase kontras gambar diambil segera sebelum panen lisat dari (C). Bilah skala = 65 µm. (F) Perwakilan blot barat menunjukkan bahwa penipisan Drp1 memberikan perlindungan hampir sebanding dari STS sebagai pengobatan SFN. Sel RPE-1 ditransfeksikan dengan 1 nM siBcl-XL dan tambahan transfected dengan 10 nM siCON atau 10 nM siDrp1. 3 hari kemudian, sel siCON telah diperlakukan sebelumnya dengan SFN seperti pada (A) dan (C) dan kemudian diekspos ke STS untuk 4 h sebelum dipanen dan diproses untuk western blotting dengan antibodi yang ditunjukkan. (G) Sama seperti (D) untuk data yang disajikan dalam (F) yang dikompilasi dari eksperimen independen 3. Bar kesalahan mencerminkan +/- SEM

Diskusi

Kami telah menemukan bahwa SFN memodulasi mitokondria fisi / fusi dinamika independen dari efeknya pada jalur KEAP1-Nrf2-ARE. Ini menarik karena diasumsikan hubungan antara disfungsi mitokondria dan produksi ROS dan perlunya memadamkan mitokondria yang diturunkan dari mitokondria melalui aktivasi Nrf2. Ini dampak fungsional tambahan dari SFN adalah potensi penting mengingat lebih dari uji klinis 30 saat ini sedang menguji SFN untuk pengobatan berbagai penyakit termasuk kanker prostat, penyakit paru obstruktif, dan penyakit sel sabit [7], [10], [ 47].

Karena SFN adalah isothiocyanate [56] dan mengaktivasi pensinyalan Nrf2 dengan langsung meng-asilasikan cysteines KEAP1 kritis untuk menekan degradasi Nrf2 [21], maka SFN memberikan efek pro-fusi dengan memodulasi aktivitas faktor fisi atau fusi melalui modifikasi sistein. . Data kami sangat mendukung Drp1 yang secara negatif diatur oleh SFN meskipun apakah GTPase adalah target langsung dari asilasi masih harus dijelaskan. Meskipun kesenjangan pengetahuan ini, fungsi Drp1 jelas dikompromikan oleh SFN karena mitokondria dan peroksisom menjadi hyperfused sebagai tanggapan atas pengobatan SFN dan organel-organel ini berbagi Drp1 untuk masing-masing peristiwa pengerutan [38]. Selain itu, SFN menurunkan jumlah Drp1 yang melokalisasi dan terakumulasi pada mitokondria (Gambar 3). Karena percobaan kami dilakukan dengan semua protein endogen, deteksi kami terhadap Drp1 di situs fisi mitokondria berada dalam kondisi steady-state, dan akibatnya, kami tidak dapat membedakan antara rekrutmen versus retensi retensi enzim yang disebabkan oleh SFN. Lebih lanjut, kami tidak dapat menghilangkan kemungkinan bahwa SFN mengakumulasi reseptor di mitokondria (Fis1 atau Mff) untuk memblokir perekrutan Drp1, kami menduga bahwa Drp1 secara langsung dimodifikasi. Drp1 memiliki sembilan cysteines, delapan di antaranya berada dalam Domain Tengah yang diperlukan untuk oligomerisasi [3], dan salah satunya berada di Domain GTPase Effector (GED) di C-terminus Drp1. Asilasi langsung dari salah satu sistein ini dapat menyebabkan cacat aktivitas pada Drp1 dan oleh karena itu mendasari efek SFN pada dinamika mitokondria. Khususnya, pekerjaan sebelumnya menunjukkan bahwa cacat dalam oligomerisasi dan aktivitas katalitik dapat membatalkan retensi Drp1 di mitokondria [52]. Cys644 dalam domain GED adalah target yang sangat menarik berdasarkan pada karya sebelumnya yang menunjukkan bahwa mutasi dari mutasi phenocopies sistein yang mengganggu aktivitas Drp1 GTPase [4] dan bahwa sistein khusus ini dimodifikasi oleh elektrofil tiol-reaktif [9]. Resolusi pertanyaan luar biasa ini akan membutuhkan validasi spektrometri massa.Di ringkasan, kami telah mengidentifikasi sebuah novel, fungsi sitoprotektif untuk SFN senyawa yang relevan secara klinis. Selain mengaktifkan faktor transkripsi anti-oksidan master Nrf2, SFN mempromosikan fusi mitokondria dan peroxisomal, dan efek ini tidak bergantung pada Nrf2. Mekanisme yang mendasari fenomena ini melibatkan pengurangan fungsi GTPase Drp1, mediator utama dari fisi mitokondria dan peroksisomal. Konsekuensi utama dari fusi mitokondria yang dimediasi oleh SFN adalah bahwa sel menjadi resisten terhadap efek racun dari staurosporine inducer apoptosis. Ini tindakan cytoprotective tambahan dari SFN bisa menjadi utilitas klinis tertentu dalam berbagai penyakit neurodegeneratif yang usia adalah faktor risiko utama (misalnya, Penyakit Parkinson, Penyakit Alzheimer, Degenerasi Makula Terkait Usia) karena penyakit ini telah dikaitkan dengan apoptosis dan berkurang. tingkat dan / atau disregulasi Nrf2 [35], [36], [48]. Bersama-sama, data ini menunjukkan bahwa sifat cytoprotective SFN melampaui aktivasi sistem KEAP1-Nrf2-ARE dan menjamin penelitian lebih lanjut mengingat penggunaan saat ini agen ini dalam beberapa uji klinis.

Bahan dan Methods

Tes Apoptosis

Sel-sel diunggulkan dan ditransfeksi dengan siRNA seperti yang ditunjukkan di bawah ini. Sel-sel pra-diobati dengan 50 μM sulforaphane untuk 2 h untuk menginduksi fusi mitokondria dan kemudian diobati dengan 1 μM staurosporine untuk menginduksi apoptosis. Pada saat panen, media dikumpulkan dalam tabung individu dan mengalami sentrifugasi kecepatan tinggi ke sel pellet apoptosis. Pelet sel ini dikombinasikan dengan sel patuh dan dilarutkan dalam buffer Laemmli terkonsentrasi 2. Sampel menjadi sasaran blotting western anti-PARP.

Pembangun Generasi CRISPR / Cas9

Untuk membuat LentiCRISPR / eCas9 1.1, LentiCRISPR v2 (addgene #52961) pertama kali dipotong dengan Age1 dan BamH1. Selanjutnya, SpCas9 dari eSpCas9 1.1 (addgene #71814) adalah PCR yang diperkuat dengan Age1 dan BamH1 overhang menggunakan primer berikut (Maju AGCGCACCGGTTCTAGAGCGCTGCCACCATGGACTATAAGGACCACGAC, Reverse AAGCGCGGATCCCTTTTCTTTTTGGTGGCCGG) dan ligated ke vektor cut di atas. Urutan sgRNA ditentukan dengan menggunakan Benchling.com. Parameter ditetapkan untuk menargetkan urutan pengkodean dengan skor tertinggi di sasaran dan terendah di luar target. Berikut urutan (menargetkan urut digarisbawahi, hs sgNFE2L2 # 1 rasa CACCGCGACGGAAAGAGTATGAGC, antisense AAACGCTCATACTCTTTCCGTCGC; hs sgNFE2L2 # 2 rasa CACCGGTTTCTGACTGGATGTGCT, antisense AAACAGCACATCCAGTCAGAAACC; hs sgNFE2L2 # 3 rasa CACCGGAGTAGTTGGCAGATCCAC, antisense AAACGTGGATCTGCCAACTACTCC) dikeraskan dan diikat ke BsmB1 memotong LentiCRISPR / eCas9 1.1. Sel RPE-1 yang terinfeksi secara renal dipilih dengan puromisin dan dipertahankan sebagai populasi yang dikumpulkan. Knockout dikonfirmasi oleh imunofluoresensi dan western blotting.

Budaya Sel dan Transfeksi

Sel-sel epitel pigmen retina manusia yang ditransformasikan dengan telomerase (RPE-1) (ATCC) dikulturkan dalam Medium Elang Modifikasi Dulbecco (DMEM) mengandung glukosa 1 g / L yang disuplementasi dengan penicillin, streptomisin, 1X cocktail asam amino non-esensial (Life Technologies), dan 10% Fetal Bovine Serum (Life Technologies). Untuk siRNA-transfections, sel 30,000-35,000 / mL dibenihkan semalaman. Sel menerima 10 nM siRNA diencerkan dalam DMEM bebas serum dan dikombinasikan dengan 0.3% Interferin transfection reagent (PolyPlus). Untuk sensitisasi apoptosis, sel menerima 1 nM Bcl-XL siRNA. Sel dipanen 2 – 3 hari setelah transfeksi.

Bahan kimia, Antibodi, dan siRNA Oligos

Antibodi terhadap α-tubulin (Cell Signaling), β-tubulin (Sigma), Drp1 (BD Biosciences), KEAP1 (Proteintech), Lamin B1 (Abcam), PARP (Cell Signalling), PMP70 (Abcam), dan Tom20 (BD Biosciences ) digunakan di 1: pengenceran 1000 untuk blotting barat dan untuk imunofluoresensi. In-house, anti-Nrf2 antibodi kelinci digunakan di 1: 2000 untuk western blotting [34], [59]. Sulforaphane (Sigma) dan staurosporine (Tocris) digunakan pada 50 μM dan 1 μM masing-masing. SiRNAs terhadap Drp1 (Dharmacon), Nrf2 (Dharmacon), KEAP1 (Cell Signalling), dan Bcl-XL (Cell Signalling) digunakan di 10 nM kecuali dinyatakan lain.

Immunofluorescence dan di Vivo Labeling

Sel yang disemai pada cover kaca 18 mm dirawat dengan kendaraan atau obat, difiksasi dalam formaldehida 3.7% dan kemudian permeabilitas pada 0.2% Triton X-100 / PBS pada es selama 10 min. Antibodi primer diinkubasi dalam albumin serum bovin 3% (BSA) dalam PBS semalam pada 4 ° C. Setelah pencucian PBS, sel diinkubasi untuk 1 h pada antibodi sekunder terkonjugasi yang sesuai dengan spesies, Alexa488- atau Alexa546- (1 yang dilemahkan: 1000) dan 0.1 μg / mL DAPI (Sigma) dalam 3% BSA / PBS. Mitokondria divisualisasikan baik oleh imunofluoresensi anti-Tom20 atau dengan sel inkubasi di 200 nM MitoTracker CMXRos Merah (Molecular Probe, Inc.) dalam DMEM bebas serum untuk 30 min pada 37 ° C sebelum fiksasi.

Mikroskopi dan Analisis Gambar

Sampel imunofluoresensi dilihat pada mikroskop LSM710 Confocal (Carl Zeiss). Mikrograf diambil menggunakan 63X atau 100X tujuan imersi minyak dan gambar disesuaikan dan ditingkatkan menggunakan Adobe Photoshop CS6. Analisis co-lokalisasi dilakukan menggunakan fitur ko-lokalisasi Carl Zeiss LSM710 dengan ambang batas yang ditetapkan secara manual sementara dibutakan oleh identitas sampel. Batang skala di seluruh, kecuali dinyatakan lain, adalah 10 µm. Morfologi mitokondria dinilai dengan skor yang dibutakan. Jika mitokondria sel dipertahankan sebagai banyak, bulat, membedakan puncta, sel itu dinilai sebagai 'fisi'. Jika mitokondria individu tidak dapat dibedakan dan seluruh jaringan mitokondria muncul terus menerus, sel itu dinilai sebagai 'fusi'. Semua sel lain, termasuk mereka yang mengelompokkan mitokondria, dinilai sebagai 'intermediate'.

Fraksinasi subselular

Sel RPE-1 tumbuh menjadi pertemuan. Setelah pencucian PBS, sel-sel menjadi sasaran sentrifugasi pada 600 × g selama 10 menit dan disuspensi dalam 600 μL buffer isolasi (210 mM Mannitol, 70 mM Sucrose, 5 mM MOPS, 1 mM EDTA pH 7.4 + 1 mM PMSF). Suspensi itu dilepaskan 30 kali dalam homogenizer Doing. Sebagian kecil dari homogenat diawetkan sebagai "lisat sel utuh." Sisanya menjadi sasaran sentrifugasi pada 800 × g untuk 10 min ke inti pelet. Supernatan menjadi sasaran sentrifugasi pada 1500 × g selama 10 menit untuk membersihkan sel-sel inti dan sel yang tersisa. Supernatan ini mengalami sentrifugasi pada 15,000 × g untuk 15 menit ke pelet mitokondria. Supernatan diawetkan sebagai "fraksi sitosol". Pellet dicuci bersih dengan PBS dan disuspensi kembali dalam buffer isolasi. Konsentrasi protein masing-masing fraksi diukur dengan asam bicinchoninic (BCA) assay dan jumlah yang setara protein diselesaikan oleh SDS-PAGE.

Western Blotting

Sel-sel dicuci dalam PBS dan dilarutkan dalam 2 kali pekat buffer Laemmli terkonsentrasi (100 mM Tris [pH 6.8], 2% SDS, 0.008% bromophenol blue, 2% 2-mercaptoethanol, 26.3% gliserol, dan 0.001% Pyrinin Y). Lisat direbus untuk 5 min sebelum memuat pada gel poliakrilamida natrium dodecyl sulfate (SDS). Protein dipindahkan ke membran nitroselulosa dan membran diblokir untuk 1 dalam 5% Susu / TBST. Antibodi primer diencerkan dalam 5% Susu / TBST dan diinkubasi dengan blot semalam pada 4 ° C. Molekul antibodi sekunder peramidase (HRP) diencerkan dalam 5% Susu / TBST. Blot diproses dengan peningkatan chemiluminescence dan kuantifikasi densitometri dilakukan menggunakan perangkat lunak ImageJ.

Dr Jimenez White Coat

Sulforaphane adalah bahan kimia dari koleksi isothiocyanate dari zat organosulfur yang diperoleh dari sayuran silangan, termasuk brokoli, kubis, kembang kol, kale, dan collard, antara lain. Sulforaphane diproduksi ketika enzim myrosinase mengubah glukoraphanin, glukosinolat, menjadi sulforaphane, juga dikenal sebagai sulforaphane-glucosinolate. Broccoli sprout dan cauliflower memiliki konsentrasi glucoraphanin tertinggi atau prekursor sulforaphane. Studi penelitian telah menunjukkan bahwa sulforaphane meningkatkan kemampuan antioksidan tubuh manusia untuk mencegah berbagai masalah kesehatan.

Dr Alex Jimenez DC, CCST Insight

Sulforaphane dan Pengaruhnya Terhadap Kanker, Kematian, Penuaan, Otak dan Perilaku, Penyakit Jantung & Lainnya

Isothiocyanate adalah beberapa senyawa tanaman yang paling penting yang bisa Anda dapatkan dalam diet Anda. Di dalam video Saya membuat kasus yang paling komprehensif untuk mereka yang pernah dibuat. Rentang perhatian yang pendek? Lewati ke topik favorit Anda dengan mengklik salah satu poin waktu di bawah ini. Penuh garis waktu di bawah ini.

Bagian utama:

  • 00: 01: 14 - Kanker dan kematian
  • 00: 19: 04 - Penuaan
  • 00: 26: 30 - Otak dan perilaku
  • 00: 38: 06 - Rekap terakhir
  • 00: 40: 27 - Dosis

Lini waktu penuh:

  • 00: 00: 34 - Pengantar sulforaphane, fokus utama dari video.
  • 00: 01: 14 - konsumsi sayuran Cruciferous dan pengurangan dalam semua penyebab kematian.
  • 00: 02: 12 - Risiko kanker prostat.
  • 00: 02: 23 - Risiko kanker kandung kemih.
  • 00: 02: 34 - Kanker paru-paru berisiko pada perokok.
  • 00: 02: 48 - Risiko kanker payudara.
  • 00: 03: 13 - Hipotetis: bagaimana jika Anda sudah menderita kanker? (intervensi)
  • 00: 03: 35 - Mekanisme mengemudi yang masuk akal kanker dan data asosiatif mortalitas.
  • 00: 04: 38 - Sulforaphane dan kanker.
  • 00: 05: 32 - Bukti binatang menunjukkan kuat efek ekstrak kecambah brokoli pada perkembangan tumor kandung kemih pada tikus.
  • 00: 06: 06 - Pengaruh suplementasi langsung sulforaphane pada pasien kanker prostat.
  • 00: 07: 09 - Bioakumulasi metabolit isothiocyanate dalam jaringan payudara yang sebenarnya.
  • 00: 08: 32 - Penghambatan sel induk kanker payudara.
  • 00: 08: 53 - Pelajaran sejarah: brassica ditetapkan memiliki sifat-sifat kesehatan bahkan di Roma kuno.
  • 00: 09: 16 - Kemampuan Sulforaphane untuk meningkatkan ekskresi karsinogen (benzena, akrolein).
  • 00: 09: 51 - NRF2 sebagai saklar genetik melalui elemen respons antioksidan.
  • 00: 10: 10 - Bagaimana aktivasi NRF2 meningkatkan ekskresi karsinogen melalui glutathione-S-conjugates.
  • 00: 10: 34 - kubis Brussel meningkatkan glutathione-S-transferase dan mengurangi kerusakan DNA.
  • 00: 11: 20 - Broccoli sprout drink meningkatkan ekskresi benzena oleh 61%.
  • 00: 13: 31 - Broccoli sprout homogenate meningkatkan enzim antioksidan di saluran napas bagian atas.
  • 00: 15: 45 - konsumsi sayuran Cruciferous dan kematian penyakit jantung.
  • 00: 16: 55 - Bubuk tunas brokoli meningkatkan lipid darah dan risiko penyakit jantung secara keseluruhan pada penderita diabetes tipe 2.
  • 00: 19: 04 - Awal mula penuaan bagian.
  • 00: 19: 21 - Diet yang diperkaya Sulforaphane meningkatkan masa hidup dari kumbang dari 15 ke 30% (dalam kondisi tertentu).
  • 00: 20: 34 - Pentingnya peradangan rendah untuk umur panjang.
  • 00: 22: 05 - Sayuran dan tunas kecambah brokoli tampaknya mengurangi beragam penanda inflamasi pada manusia.
  • 00: 23: 40 - Rekap video pertengahan: kanker, bagian penuaan
  • 00: 24: 14 - Studi pada tikus menunjukkan sulforaphane dapat meningkatkan fungsi imun adaptif di usia tua.
  • 00: 25: 18 - Sulforaphane meningkatkan pertumbuhan rambut pada model tikus botak. Gambar di 00: 26: 10.
  • 00: 26: 30 - Awal dari bagian otak dan perilaku.
  • 00: 27: 18 - Pengaruh ekstrak kecambah brokoli pada autisme.
  • 00: 27: 48 - Pengaruh glucoraphanin pada skizofrenia.
  • 00: 28: 17 - Mulai dari diskusi depresi (mekanisme dan studi yang masuk akal).
  • 00: 31: 21 - Studi mouse menggunakan 10 model yang berbeda dari depresi yang diinduksi stres menunjukkan sulforaphane sama efektifnya dengan fluoxetine (prozac).
  • 00: 32: 00 - Studi menunjukkan konsumsi langsung glukoraphanin pada tikus juga efektif mencegah depresi dari model stres kekalahan sosial.
  • 00: 33: 01 - Awal dari bagian neurodegenerasi.
  • 00: 33: 30 - Sulforaphane dan penyakit Alzheimer.
  • 00: 33: 44 - Sulforaphane dan penyakit Parkinson.
  • 00: 33: 51 - Sulforaphane dan penyakit Hungtington.
  • 00: 34: 13 - Sulforaphane meningkatkan protein heat shock.
  • 00: 34: 43 - Awal dari bagian cedera otak traumatis.
  • 00: 35: 01 - Sulforaphane disuntikkan segera setelah TBI meningkatkan daya ingat (studi pada tikus).
  • 00: 35: 55 - Sulforaphane dan plastisitas neuronal.
  • 00: 36: 32 - Sulforaphane meningkatkan pembelajaran di model diabetes tipe II pada tikus.
  • 00: 37: 19 - Sulforaphane dan duchenne distrofi otot.
  • 00: 37: 44 - Myostatin inhibition dalam sel-sel satelit otot (in vitro).
  • 00: 38: 06 - Rekap video-ulang: mortalitas dan kanker, kerusakan DNA, stres oksidatif dan peradangan, ekskresi benzena, penyakit kardiovaskular, diabetes tipe II, efek pada otak (depresi, autisme, skizofrenia, neurodegenerasi), jalur NRF2.
  • 00: 40: 27 - Pikiran tentang mencari tahu kecambah brokoli atau sulforaphane.
  • 00: 41: 01 - Anekdot saat bertumbuh di rumah.
  • 00: 43: 14 - Pada suhu memasak dan aktivitas sulforaphane.
  • 00: 43: 45 - Konversi bakteri usus dari sulforaphane dari glucoraphanin.
  • 00: 44: 24 - Suplemen bekerja lebih baik ketika dikombinasikan dengan myrosinase aktif dari sayuran.
  • 00: 44: 56 - Teknik memasak dan sayuran silangan.
  • 00: 46: 06 - Isothiocyanate sebagai goitrogens.

Ucapan Terima Kasih

Sciencedirect.com/science/article/pii/S2213231716302750

Bagaimana Sulforaphane Diproduksi?

Pemanasan Menurunkan Aktivitas Protein Epithiospecifier dan Meningkatkan Formasi Sulforaphane di Brokoli

Abstrak

Sulforaphane, isothiocyanate dari brokoli, adalah salah satu anticarcinogen yang paling kuat berasal dari makanan. Senyawa ini tidak ada dalam sayuran utuh, melainkan dibentuk dari prekursor glucosinolate, glucoraphanin, oleh aksi myrosinase, enzim thioglucosidase, ketika jaringan brokoli dihancurkan atau dikunyah. Namun, sejumlah penelitian telah menunjukkan bahwa hasil sulforaphane dari glucoraphanin adalah rendah, dan bahwa analog nitril non-bioaktif, nitrile sulforaphane, adalah produk hidrolisis utama ketika jaringan tanaman dihancurkan pada suhu kamar. Bukti terbaru menunjukkan bahwa di Arabidopsis, pembentukan nitril dari glukosinolat dikendalikan oleh protein yang peka terhadap panas, epithiospecifier protein (ESP), sebuah kofaktor non-katalitik myrosinase. Tujuan kami adalah untuk menguji pengaruh pemanasan kuntum dan kecambah brokoli pada pembentukan nitrile sulforaphane dan sulforaphane, untuk menentukan apakah brokoli mengandung aktivitas ESP, kemudian untuk mengkorelasikan perubahan yang tergantung pada panas dalam aktivitas ESP, kandungan sulforaphane dan bioaktivitas, yang diukur dengan induksi dari fase II enzim detoksifikasi quinone reductase (QR) dalam kultur sel. Pemanasan brokoli segar atau kecambah brokoli ke 60 ° C sebelum homogenisasi secara bersamaan meningkatkan pembentukan sulforaphane dan menurunkan pembentukan nitril sulforaphane. Kehilangan aktivitas ESP yang signifikan sejajar dengan penurunan pembentukan nitril sulforaphane. Pemanasan ke 70 ° C dan di atas menurunkan pembentukan kedua produk dalam kuntum brokoli, tetapi tidak dalam kecambah brokoli. Induksi QR pada hepatoma tikus yang dikultur Hepa lclc7 sel paralel peningkatan dalam pembentukan sulforaphane.

Pra-pemanasan kuntum brokoli dan kecambah ke 60 ° C secara signifikan meningkatkan pembentukan sulfonat teroksidasi-myrosinase (SF) dalam ekstrak jaringan sayuran setelah dihancurkan. Ini terkait dengan penurunan nitril sulfat (SF Nitrile) formasi dan aktivitas epithiospecifier protein (ESP).

Kata kunci: Brokoli, Brassica oleracea, Cruciferae, Kanker, Anticarcinogen, Sulforaphane, Sulforaphane nitril, protein Epithiospecifier, Quinone reductase

Kesimpulannya, sulforaphane adalah phytochemical yang ditemukan di Brokoli,dan sayuran silangan lainnya. Suatu jumlah oksidan yang tidak terkendali yang disebabkan oleh faktor internal dan eksternal dapat menyebabkan stres oksidatif dalam tubuh manusia yang pada akhirnya dapat menyebabkan berbagai masalah kesehatan. Sulforaphane dapat mengaktifkan produksi Nrf2, faktor transkripsi yang membantu mengatur mekanisme antioksidan pelindung yang mengendalikan respon sel terhadap oksidan. Ruang lingkup informasi kami terbatas pada masalah kesehatan chiropraktik dan tulang belakang. Untuk mendiskusikan materi pelajaran, silakan bertanya kepada Dr. Jimenez atau hubungi kami di 915-850-0900 .

Diundangkan oleh Dr. Alex Jimenez

Direferensikan dari: Sciencedirect.com

Tombol Panggilan Hijau Sekarang H .png

Diskusi Topik Tambahan: Nyeri Punggung Akut

Nyeri punggung adalah salah satu penyebab kecacatan dan hari-hari yang terlewatkan di dunia kerja. Nyeri punggung atribut untuk alasan paling umum kedua untuk kunjungan kantor dokter, kalah jumlah hanya oleh infeksi saluran pernapasan atas. Sekitar 80 persen populasi akan mengalami sakit punggung setidaknya sekali sepanjang hidup mereka. Tulang belakang adalah struktur kompleks yang terdiri dari tulang, sendi, ligamen, dan otot, di antara jaringan lunak lainnya. Karena ini, cedera dan / atau kondisi yang diperburuk, seperti cakram hernia, akhirnya dapat menyebabkan gejala nyeri punggung. Cedera olahraga atau cedera kecelakaan mobil sering menjadi penyebab paling sering dari nyeri punggung, namun terkadang gerakan yang paling sederhana dapat memiliki hasil yang menyakitkan. Untungnya, pilihan pengobatan alternatif, seperti perawatan chiropractic, dapat membantu meringankan nyeri punggung melalui penggunaan penyesuaian tulang belakang dan manipulasi manual, yang pada akhirnya meningkatkan pereda nyeri.

gambar blog kartun kertas anak laki-laki

EXTRA EXTRA | TOPIK PENTING: Direkomendasikan El Paso, TX Chiropractor

***